pTorPE-Y-GECO2f
(Plasmid
#105065)
-
PurposeA yellow fluorescent Ca2+ indicator variant with low binding affinity and fast kinetics for expression in bacterial
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCustomized Vector
- Backbone size w/o insert (bp) 4118
- Total vector size (bp) 5486
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameY-GECO2f
-
SpeciesSynthetic
-
Insert Size (bp)1368
-
GenBank IDMG450564
- Promoter pBAD
-
Tag
/ Fusion Protein
- 6x His tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This gene is a variant of pTorPE-Y-GECO1 (Plasmid #55765)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTorPE-Y-GECO2f was a gift from Robert Campbell (Addgene plasmid # 105065 ; http://n2t.net/addgene:105065 ; RRID:Addgene_105065) -
For your References section:
Inverse-response Ca(2+) indicators for optogenetic visualization of neuronal inhibition. Zhao Y, Bushey D, Zhao Y, Schreiter ER, Harrison DJ, Wong AM, Campbell RE. Sci Rep. 2018 Aug 6;8(1):11758. doi: 10.1038/s41598-018-30080-x. 10.1038/s41598-018-30080-x PubMed 30082904