pKLV2-U6gRNA5(Tcf7l1-g2)-PGKpuroBFP-W
(Plasmid
#105016)
-
PurposeLentiviral gRNA plasmid targeting mouse Tcf7l1 , co-expression of TagBFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W
-
Backbone manufacturerYusa Lab
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTcf7l1
-
gRNA/shRNA sequenceGCTGTCTTTGGGTCGATCTC
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6gRNA5(Tcf7l1-g2)-PGKpuroBFP-W was a gift from Kosuke Yusa (Addgene plasmid # 105016 ; http://n2t.net/addgene:105016 ; RRID:Addgene_105016) -
For your References section:
Genome-wide CRISPR-KO Screen Uncovers mTORC1-Mediated Gsk3 Regulation in Naive Pluripotency Maintenance and Dissolution. Li M, Yu JSL, Tilgner K, Ong SH, Koike-Yusa H, Yusa K. Cell Rep. 2018 Jul 10;24(2):489-502. doi: 10.1016/j.celrep.2018.06.027. 10.1016/j.celrep.2018.06.027 PubMed 29996108