-
PurposeMammalian Expression of mtagBFP2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemtagBFP2
-
SpeciesSynthetic
-
Insert Size (bp)966
- Promoter CAG
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctacagctcctgggcaacgt
- 3′ sequencing primer AAGATCTCAGTGGTATTTGTGAGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-AKAP-mtagBFP2-UBC6 was a gift from Franck Polleux (Addgene plasmid # 105007 ; http://n2t.net/addgene:105007 ; RRID:Addgene_105007) -
For your References section:
ER-mitochondria tethering by PDZD8 regulates Ca(2+) dynamics in mammalian neurons. Hirabayashi Y, Kwon SK, Paek H, Pernice WM, Paul MA, Lee J, Erfani P, Raczkowski A, Petrey DS, Pon LA, Polleux F. Science. 2017 Nov 3;358(6363):623-630. doi: 10.1126/science.aan6009. 10.1126/science.aan6009 PubMed 29097544