lenti-SpCas9 hygro
(Plasmid #104995)

• Purpose: This lentiviral construct delivers hSpCas9 and hygromycin resistance.
• Depositing Lab: Brett Stringer
• Publication: Stringer et al Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z.

Backbone

• Vector backbone: lentiCRISPRv2 hygro (Addgene #98291)
• Backbone manufacturer: Brett Stringer from Feng Zhang plasmid lentiCRISPR v2 (Addgene plasmid #52961)
• Total vector size (bp): 13055
• Modifications to backbone: The first of the two MluI restriction sites of lentiCRISPR v2 (Addgene plasmid #52961) was mutated (to create lentiCRISPRv2 puro, Addgene plasmid #98290) to allow the subcloning of alternative P2A-antibiotic resistance cassettes between the BamHI and remaining MluI restriction site (see also lentiCRISPRv2 hygro, Addgene plasmid #98291; lentiCRISPRv2 neo, Addgene plasmid #98292; and lentiCRISPRv2 blast, Addgene plasmid #98293). The U6 promoter-2 kb BsmBI-BsmBI filler cassette of lentiCRISPRv2 hygro (Addgene plasmid #98291) was removed by KpnI/NheI digestion and a KpnI-XhoI-BsrGI-NheI double-stranded oligonucleotide sequence was cloned in its place between the KpnI and NheI restriction sites (see also lentiCas9 puro, Addgene plasmid #104994; lentiCas9 neo, Addgene plasmid #104996; and lentiCas9 blast, Addgene plasmid #104997).
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl4
• Growth instructions: Single colonies of transformed STBL3 or STBL4 cells cultured in 5 ml of LB broth containing 100 micrograms/ml ampicillin for 20 hours at 37C, 200 rpm give good yields for plasmid minipreps.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KpnI-XhoI-BsrGI-NheI
• Species: Synthetic
• Insert Size (bp): 24

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: acagtgcaggggaaagaatagtaga
• 3′ sequencing primer: aagcagcgtatccacatagc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Feng Zhang (Addgene plasmid # 52961)
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry