Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSMPP-mCherry-hTRIM21
(Plasmid #104972)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104972 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSMPP
  • Backbone manufacturer
    William A. McEwan (MRC LMB)
  • Backbone size w/o insert (bp) 10016
  • Total vector size (bp) 12112
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tripartite Motif containing 21
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1428
  • GenBank ID
  • Entrez Gene
    TRIM21 (a.k.a. RNF81, RO52, Ro/SSA, SSA, SSA1)
  • Promoter SFFV
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site none (unknown if destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGCTTCTCGCTTCTGTTCG
  • 3′ sequencing primer ATAGCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSMPP-mCherry-hTRIM21 was a gift from Leo James (Addgene plasmid # 104972 ; http://n2t.net/addgene:104972 ; RRID:Addgene_104972)
  • For your References section:

    A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837