pSMPP-mCherry-mTrim21
(Plasmid #104971)

• Purpose: Lentiviral Transfer Plasmid with mCherry-tagged mouse Trim21
• Depositing Lab: Leo James
• Publication: Clift et al Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033.

Backbone

• Vector backbone: pSMPP
• Backbone manufacturer: William A. McEwan (MRC LMB)
• Backbone size w/o insert (bp): 10016
• Total vector size (bp): 12127
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tripartite Motif containing 21
• Species: M. musculus (mouse)
• Insert Size (bp): 1428
• GenBank ID:
• Entrez Gene: Trim21 (a.k.a. Ro52, Ssa1)
• Promoter: SFFV
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: NdeI (not destroyed)
• 5′ sequencing primer: TGCTTCTCGCTTCTGTTCG
• 3′ sequencing primer: ATAGCGTAAAAGGAGCAACATAG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry