pDONR201-JIP60ml
(Plasmid #104959)

• Purpose: Encodes a modified, active, form of Hordeum vulgare c.v. Golden Promise Jasmonate Induced Protein 60 (JIP60)
• Depositing Lab: Pietro Spanu
• Publication: Pennington et et al Figshare (2018)

Backbone

• Vector backbone: pDONR201
• Backbone manufacturer: Gateway
• Backbone size w/o insert (bp): 4470
• Total vector size (bp): 3053
• Vector type: Gateway entry vector for LR recombination into other Gateway compatible vectors

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Jasmonate Induced Protein 60 (JIP60)
• Species: Hordeum vulgare c.v. Golden Promise
• Insert Size (bp): 796
• Mutation: Replaced amino acids 164 to 187 with a methionine, leucine, aspartic acid & proline (MLDP) linker, and removed the C-terminus (amino acids 165 onwards). Both changes are required for JIP60's post-translational activity. Mak et al., (2007) had previously shown that the linker removal was required to produce an active form of maize ribosome-inactivating protein (b-32).Mak, A. N.-S., et al (2007) “Structure-function study of maize ribosome-inactivating protein: implications for the internal inactivation region and the sole glutamate in the active site”, Nucleic Acids Research, 35(18), 6259-6267.
• GenBank ID: KY929371

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gatctcgggccccaaataatg
• 3′ sequencing primer: ctgcagctggatggcaaataatg

Resource Information

• Supplemental Documents:
  • 20171121_pDONR201_JIP60ml.ape
• A portion of this plasmid was derived from a plasmid made by: I (Helen Pennington) cloned the initial gene from Hordeum vulgare c.v. Golden Promise cDNA. Rhian Jones performed the modifications, i.e. excising the inhibitory peptide and replacing it with a methionine-leucine linker.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Pennington, H.G., Jones, R., Przydacz, M. and Spanu, P. An active form of Jasmonate Induced Protein 60 (JIP60) from Hordeum vulgare cv. Golden Promise. Figshare (2018). 10.6084/m9.figshare.5625607