Skip to main content
Addgene

pDONR201-JIP60ml
(Plasmid #104959)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104959 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDONR201
  • Backbone manufacturer
    Gateway
  • Backbone size w/o insert (bp) 4470
  • Total vector size (bp) 3053
  • Vector type
    Gateway entry vector for LR recombination into other Gateway compatible vectors

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Jasmonate Induced Protein 60 (JIP60)
  • Species
    Hordeum vulgare c.v. Golden Promise
  • Insert Size (bp)
    796
  • Mutation
    Replaced amino acids 164 to 187 with a methionine, leucine, aspartic acid & proline (MLDP) linker, and removed the C-terminus (amino acids 165 onwards). Both changes are required for JIP60's post-translational activity. Mak et al., (2007) had previously shown that the linker removal was required to produce an active form of maize ribosome-inactivating protein (b-32).Mak, A. N.-S., et al (2007) “Structure-function study of maize ribosome-inactivating protein: implications for the internal inactivation region and the sole glutamate in the active site”, Nucleic Acids Research, 35(18), 6259-6267.
  • GenBank ID
    KY929371

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gatctcgggccccaaataatg
  • 3′ sequencing primer ctgcagctggatggcaaataatg
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    I (Helen Pennington) cloned the initial gene from Hordeum vulgare c.v. Golden Promise cDNA. Rhian Jones performed the modifications, i.e. excising the inhibitory peptide and replacing it with a methionine-leucine linker.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Pennington, H.G., Jones, R., Przydacz, M. and Spanu, P. An active form of Jasmonate Induced Protein 60 (JIP60) from Hordeum vulgare cv. Golden Promise. Figshare (2018). 10.6084/m9.figshare.5625607

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR201-JIP60ml was a gift from Pietro Spanu (Addgene plasmid # 104959 ; http://n2t.net/addgene:104959 ; RRID:Addgene_104959)

  • For your References section:

    An active form of Jasmonate Induced Protein 60 (JIP60) from Hordeum vulgare cv. Golden Promise. Pennington et al.. Figshare (2018) 10.6084/m9.figshare.5625607
Related items: