pICH47732:PtFCP:ShBle
(Plasmid #104893)

• Purpose: Expresses ShBle with FCP promoter/terminator, Golden Gate Assembly, for Phaeodactylum transformation.
• Depositing Lab: Thomas Mock
• Publication: Graff van Creveld et al Front Microbiol. 2021 Sep 8;12:688199. doi: 10.3389/fmicb.2021.688199. eCollection 2021.

Backbone

• Vector backbone: pICH47732
• Backbone size w/o insert (bp): 4386
• Total vector size (bp): 5243
• Vector type: Phaeodactylum; Golden Gate Assembly
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ShBle
• Alt name: Bleomycin resistance protein
• Tag / Fusion Protein:
  • PtFCP promoter and terminator

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: ggataaaccttttcacgccc

Resource Information

• Supplemental Documents:
  • L1 P-Ble-T.gb
• A portion of this plasmid was derived from a plasmid made by: pPha-TI plasmid, described in Zaslavskaia L, Lippmeier C, Kroth P. Grossman A, Apt Kirk. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. Was domesticated by removing and BpiI sites through site directed mutagenesis from the FCP promoter and terminator, was then inserted into an L1 pICH47732 vector.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was assembled using Golden Gate Cloning.

Please visit https://www.biorxiv.org/content/early/2018/10/17/444109 for bioRxiv preprint.