Skip to main content
Addgene

PE_26: Para_Lac_Tet_eG::sfYFP
(Plasmid #104887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104887 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmb1, +ROP
  • Backbone size w/o insert (bp) 3886
  • Total vector size (bp) 3971
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hybrid Promoter Para_Lac_Tet_eG
  • Insert Size (bp)
    85
  • Promoter Para_Lac_Tet_eG

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CATTTCTGAAGAGGACTTGTTGCG
  • 3′ sequencing primer CTTCACCCTCGCCACGCACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PE_26: Para_Lac_Tet_eG::sfYFP was a gift from Matthew Bennett (Addgene plasmid # 104887 ; http://n2t.net/addgene:104887 ; RRID:Addgene_104887)
  • For your References section:

    Tuning the dynamic range of bacterial promoters regulated by ligand-inducible transcription factors. Chen Y, Ho JML, Shis DL, Gupta C, Long J, Wagner DS, Ott W, Josic K, Bennett MR. Nat Commun. 2018 Jan 4;9(1):64. doi: 10.1038/s41467-017-02473-5. 10.1038/s41467-017-02473-5 PubMed 29302024