Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PE_20: Pxyl_lac_eG::sfYFP
(Plasmid #104881)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104881 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmb1, +ROP
  • Backbone size w/o insert (bp) 3886
  • Total vector size (bp) 3971
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BW25113
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hybrid Promoter : Pxyl_lac_eG
  • Promoter Hybrid Promoter : Pxyl_lac_eG

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CATTTCTGAAGAGGACTTGTTGCG
  • 3′ sequencing primer CTTCACCCTCGCCACGCACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Plasmid contains a tet operator instead of a lac operator between rop and myc. This change is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PE_20: Pxyl_lac_eG::sfYFP was a gift from Matthew Bennett (Addgene plasmid # 104881 ; http://n2t.net/addgene:104881 ; RRID:Addgene_104881)
  • For your References section:

    Tuning the dynamic range of bacterial promoters regulated by ligand-inducible transcription factors. Chen Y, Ho JML, Shis DL, Gupta C, Long J, Wagner DS, Ott W, Josic K, Bennett MR. Nat Commun. 2018 Jan 4;9(1):64. doi: 10.1038/s41467-017-02473-5. 10.1038/s41467-017-02473-5 PubMed 29302024