pSC29
(Plasmid
#104803)
-
PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSC218
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMedtr4g094545
-
Alt nameHen1
-
gRNA/shRNA sequencetacatctgaacaacatatcg, tccaaagcaatcagattca
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
112-31:12.1. Alternative name of plasmid: pSG218GG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSC29 was a gift from Robert Stupar (Addgene plasmid # 104803 ; http://n2t.net/addgene:104803 ; RRID:Addgene_104803) -
For your References section:
CRISPR/Cas9 and TALENs generate heritable mutations for genes involved in small RNA processing of Glycine max and Medicago truncatula. Curtin SJ, Xiong Y, Michno JM, Campbell BW, Stec AO, Cermak T, Starker C, Voytas DF, Eamens AL, Stupar RM. Plant Biotechnol J. 2017 Oct 31. doi: 10.1111/pbi.12857. 10.1111/pbi.12857 PubMed 29087011