CMV-ShadowG
(Plasmid
#104620)
-
PurposeExpresses Shadow G in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104620 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * | |
* Log in to view industry pricing.
Backbone
-
Vector backboneCustomized Vector
- Backbone size w/o insert (bp) 3290
- Total vector size (bp) 4004
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameShadowG
-
SpeciesAequorea victoria (jellyfish)
-
Insert Size (bp)717
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-ShadowG was a gift from Hideji Murakoshi (Addgene plasmid # 104620 ; http://n2t.net/addgene:104620 ; RRID:Addgene_104620) -
For your References section:
A dark green fluorescent protein as an acceptor for measurement of Forster resonance energy transfer. Murakoshi H, Shibata AC, Nakahata Y, Nabekura J. Sci Rep. 2015 Oct 15;5:15334. doi: 10.1038/srep15334. 10.1038/srep15334 PubMed 26469148
Map uploaded by the depositor.
Map uploaded by the depositor.
