Skip to main content
Addgene

pJFRC81-3xVAS3-IVS-Syn21-GFP-P10
(Plasmid #104614)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104614 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJFRC81 (Plasmid #36432)
  • Backbone manufacturer
    Gerald Rubin
  • Backbone size w/o insert (bp) 8358
  • Total vector size (bp) 8418
  • Modifications to backbone
    10xUAS replaced with 3xVAS3
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3xVAS3
  • Species
    Synthetic
  • Insert Size (bp)
    60
  • Promoter hsp70

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer CGGTGATTCATTCTGCTAACCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's sequencing results found a G->A mutation in the 2nd VAS3 sequence. The depositing lab states that this mutation should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC81-3xVAS3-IVS-Syn21-GFP-P10 was a gift from Tudor Fulga (Addgene plasmid # 104614 ; http://n2t.net/addgene:104614 ; RRID:Addgene_104614)
  • For your References section:

    A multiplexable TALE-based binary expression system for in vivo cellular interaction studies. Toegel M, Azzam G, Lee EY, Knapp DJHF, Tan Y, Fa M, Fulga TA. Nat Commun. 2017 Nov 21;8(1):1663. doi: 10.1038/s41467-017-01592-3. 10.1038/s41467-017-01592-3 PubMed 29162808