pG-HIV-LRT
(Plasmid
#104592)
-
PurposeStandard for qPCR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGemT
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3001
-
Vector typecloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHIV-1 late reverse transcripts
-
SpeciesHIV-1 virus
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer T7-F TAATACGACTCACTATAGGG and SP6-F ATTTAGGTGACACTATAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid may be used as a qPCR standard for the measure of HIV-1 virus. It encodes a short fragment of the HIV-1 genome corresponding to 557-699 bp in the HXB2 reference strain sequence. This sequence corresponds to 674-816 bp in reverse in the Addgene sequence file. It may be amplified with primers MH531 (5' TGTGTGCCCGTCTGTTGTGT), MH532 (5' GAGTCCTGCGTCGAGAGAGC), and Taqman probe LRT-P (5' CAGTGGCGCCCGAACAGGGA)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pG-HIV-LRT was a gift from Kristine Yoder (Addgene plasmid # 104592 ; http://n2t.net/addgene:104592 ; RRID:Addgene_104592) -
For your References section:
Real-time quantitative PCR and fast QPCR have similar sensitivity and accuracy with HIV cDNA late reverse transcripts and 2-LTR circles. Yoder KE, Fishel R. J Virol Methods. 2008 Nov;153(2):253-6. doi: 10.1016/j.jviromet.2008.07.032. Epub 2008 Sep 17. 10.1016/j.jviromet.2008.07.032 PubMed 18762215