pG-HIV-SIN-2LTR
(Plasmid
#104591)
-
PurposeStandard for qPCR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGemT
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3001
-
Vector typecloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2LTR circle junction of self-inactivating HIV-based vectors
-
SpeciesHIV-1 based vector
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer T7-F TAATACGACTCACTATAGGG and SP6-F ATTTAGGTGACACTATAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The self-inactivating (SIN) HIV-1 vector has sequence from the LTR deleted, including the sequence encoded by qPCR primer MH536. An alternative primer set and qPCR standard plasmid was made to detect HIV-1 SIN vector 2LTR circles. The 2LTR circle insert is Addgene 753-929 bp. It may be amplified with primers MH535 (5' AACTAGGGAACCCACTGCTTAAG), KY268 (5' CCAGAGAGACCCAGTACAAGCA), and Taqman probe MH603 (5' ACACTACTTGAAGCACTCAAGGCAAGCTTT)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pG-HIV-SIN-2LTR was a gift from Kristine Yoder (Addgene plasmid # 104591 ; http://n2t.net/addgene:104591 ; RRID:Addgene_104591) -
For your References section:
Real-time quantitative PCR and fast QPCR have similar sensitivity and accuracy with HIV cDNA late reverse transcripts and 2-LTR circles. Yoder KE, Fishel R. J Virol Methods. 2008 Nov;153(2):253-6. doi: 10.1016/j.jviromet.2008.07.032. Epub 2008 Sep 17. 10.1016/j.jviromet.2008.07.032 PubMed 18762215