pAAV-HDR-mEGFP-camk2a
(Plasmid #104589)

• Purpose: AAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2a
• Depositing Lab: Ryohei Yasuda
• Publication: Nishiyama et al Neuron. 2017 Oct 18. pii: S0896-6273(17)30933-9. doi: 10.1016/j.neuron.2017.10.004.

Backbone

• Vector backbone: PX551
• Backbone size w/o insert (bp): 2905
• Total vector size (bp): 5836
• Vector type: Mouse Targeting, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: calcium/calmodulin-dependent protein kinase II alpha
• Alt name: camk2a
• gRNA/shRNA sequence: ctgcctgcccagtgccagga
• Species: M. musculus (mouse)
• Entrez Gene: Camk2a (a.k.a. CaMKII, mKIAA0968)
• Promoter: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ACTATCATATGCTTACCGTAAC
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCA

Resource Information

• Supplemental Documents:
  • pAAV-HDR-mEGFP-camk2a.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry