Skip to main content
Addgene

pET14b – E. coli Exonuclease I
(Plasmid #104552)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104552 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET14b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 4671
  • Total vector size (bp) 6119
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Exonuclease I
  • Species
    E.coli
  • Insert Size (bp)
    1448
  • Entrez Gene
    sbcB (a.k.a. b2011, ECK2005, JW1993, cpeA, xonA)
  • Promoter T7
  • Tag / Fusion Protein
    • 6X-His tag followed by thrombin site

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer T7-F TAATACGACTCACTATAGGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET14b – E. coli Exonuclease I was a gift from Charles Bell (Addgene plasmid # 104552 ; http://n2t.net/addgene:104552 ; RRID:Addgene_104552)

  • For your References section:

    Crystal structures of Escherichia coli exonuclease I in complex with single-stranded DNA provide insights into the mechanism of processive digestion. Korada SK, Johns TD, Smith CE, Jones ND, McCabe KA, Bell CE. Nucleic Acids Res. 2013 Jun;41(11):5887-97. doi: 10.1093/nar/gkt278. Epub 2013 Apr 22. 10.1093/nar/gkt278 PubMed 23609540
Related items:
Commonly requested with: