Skip to main content
Addgene

optoPKAW196R
(Plasmid #104548)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104548 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmCherryCry2
  • Backbone manufacturer
    Chandra Tucker
  • Backbone size w/o insert (bp) 6219
  • Total vector size (bp) 7272
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cry2-mCherry-PKA W196R
  • Alt name
    optoPKA
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    3327
  • Mutation
    PKA W196R
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PKA catalytic subunit was a gift from Dr. Susan Taylor.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    optoPKAW196R was a gift from David Lawrence (Addgene plasmid # 104548 ; http://n2t.net/addgene:104548 ; RRID:Addgene_104548)
  • For your References section:

    Design and Profiling of a Subcellular Targeted Optogenetic cAMP-Dependent Protein Kinase. O'Banion CP, Priestman MA, Hughes RM, Herring LE, Capuzzi SJ, Lawrence DS. Cell Chem Biol. 2017 Oct 25. pii: S2451-9456(17)30355-0. doi: 10.1016/j.chembiol.2017.09.011. 10.1016/j.chembiol.2017.09.011 PubMed 29104065