optoPKAW196R
(Plasmid #104548)

• Purpose: Expresses Cry2-mCherry-PKA W196R in mammalian cells
• Depositing Lab: David Lawrence
• Publication: O'Banion et al Cell Chem Biol. 2017 Oct 25. pii: S2451-9456(17)30355-0. doi: 10.1016/j.chembiol.2017.09.011.

Backbone

• Vector backbone: pmCherryCry2
• Backbone manufacturer: Chandra Tucker
• Backbone size w/o insert (bp): 6219
• Total vector size (bp): 7272
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cry2-mCherry-PKA W196R
• Alt name: optoPKA
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 3327
• Mutation: PKA W196R
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: PKA catalytic subunit was a gift from Dr. Susan Taylor.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry