-
PurposePiggyBac vector encoding Tet-On 3G constitutively expressed by EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePiggyBac
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet-On 3G
-
SpeciesSynthetic
-
Insert Size (bp)747
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (unknown if destroyed)
- 3′ cloning site HpaI (unknown if destroyed)
- 5′ sequencing primer gagagctcgtttagtgaacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byClontech
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-EF1a-TetOn3G was a gift from David Vereide (Addgene plasmid # 104543 ; http://n2t.net/addgene:104543 ; RRID:Addgene_104543) -
For your References section:
Expandable Arterial Endothelial Precursors from Human CD34(+) Cells Differ in Their Proclivity to Undergo an Endothelial-to-Mesenchymal Transition. Miller AZ, Satchie A, Tannenbaum AP, Nihal A, Thomson JA, Vereide DT. Stem Cell Reports. 2018 Jan 9;10(1):73-86. doi: 10.1016/j.stemcr.2017.12.011. 10.1016/j.stemcr.2017.12.011 PubMed 29320761