Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB-EF1a-TetOn3G
(Plasmid #104543)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104543 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PiggyBac
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tet-On 3G
  • Species
    Synthetic
  • Insert Size (bp)
    747
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (unknown if destroyed)
  • 3′ cloning site HpaI (unknown if destroyed)
  • 5′ sequencing primer gagagctcgtttagtgaacc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Clontech
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-EF1a-TetOn3G was a gift from David Vereide (Addgene plasmid # 104543 ; http://n2t.net/addgene:104543 ; RRID:Addgene_104543)
  • For your References section:

    Expandable Arterial Endothelial Precursors from Human CD34(+) Cells Differ in Their Proclivity to Undergo an Endothelial-to-Mesenchymal Transition. Miller AZ, Satchie A, Tannenbaum AP, Nihal A, Thomson JA, Vereide DT. Stem Cell Reports. 2018 Jan 9;10(1):73-86. doi: 10.1016/j.stemcr.2017.12.011. 10.1016/j.stemcr.2017.12.011 PubMed 29320761