-
Purposebacterial expression of lambda exonuclease
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104531 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepET14b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 4671
- Total vector size (bp) 5352
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameλ exonuclease
-
Speciesbacteriophage lambda
-
Insert Size (bp)681
- Promoter T7
-
Tag
/ Fusion Protein
- His6 followed by a thrombin site (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer T7-F TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET14b – lambda exonuclease was a gift from Charles Bell (Addgene plasmid # 104531 ; http://n2t.net/addgene:104531 ; RRID:Addgene_104531) -
For your References section:
Crystal structures of lambda exonuclease in complex with DNA suggest an electrostatic ratchet mechanism for processivity. Zhang J, McCabe KA, Bell CE. Proc Natl Acad Sci U S A. 2011 Jul 19;108(29):11872-7. doi: 10.1073/pnas.1103467108. Epub 2011 Jul 5. 10.1073/pnas.1103467108 PubMed 21730170
