Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET14b – lambda exonuclease
(Plasmid #104531)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104531 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET14b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 4671
  • Total vector size (bp) 5352
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    λ exonuclease
  • Species
    bacteriophage lambda
  • Insert Size (bp)
    681
  • Promoter T7
  • Tag / Fusion Protein
    • His6 followed by a thrombin site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer T7-F TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET14b – lambda exonuclease was a gift from Charles Bell (Addgene plasmid # 104531 ; http://n2t.net/addgene:104531 ; RRID:Addgene_104531)
  • For your References section:

    Crystal structures of lambda exonuclease in complex with DNA suggest an electrostatic ratchet mechanism for processivity. Zhang J, McCabe KA, Bell CE. Proc Natl Acad Sci U S A. 2011 Jul 19;108(29):11872-7. doi: 10.1073/pnas.1103467108. Epub 2011 Jul 5. 10.1073/pnas.1103467108 PubMed 21730170