AAV-FLEX-mCherry-FHA1-subT391A-mCherry
(Plasmid #104462)

• Purpose: Cre-dependent, Non-phosphorylatable PKA consensus substrate tagged with mCherry
• Depositing Lab: Bernardo Sabatini
• Publication: Chen et al Neuron. 2017 Dec 6;96(5):1070-1083.e5. doi: 10.1016/j.neuron.2017.10.023. Epub 2017 Nov 16.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV-FLEX
• Backbone manufacturer: Scott Sternson
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 6988
• Modifications to backbone: None
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mCherry-subT391A-FHA1-mCherry
• Alt name: mCherry-tagged PKA consensus substrate (with T391A mutation)
• Species: Synthetic
• Insert Size (bp): 1957
• Promoter: CAG
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: GAGGTTGATTATCGATAAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositing laboratory would like to note the presence of small sequence discrepancies, between the NGS result and their own reference sequence, in the second ITR. Please note that the depositing lab has only used this vector for in utero electroporation, and has not generated AAV from it