pEGFPC1-hVAP-B KD/MD
(Plasmid #104450)

• Purpose: Expression of human VAP-B (mutant K87D/M89D, unable to bind FFAT motifs) fused to GFP in mammalian cells
• Depositing Lab: Catherine Tomasetto
• Publication: Alpy et al J Cell Sci. 2013 Dec 1;126(Pt 23):5500-12. doi: 10.1242/jcs.139295. Epub 2013 Oct 8.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 5506
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: vesicle-associated membrane protein-associated protein B
• Alt name: VAP-B
• Species: H. sapiens (human)
• Insert Size (bp): 732
• Mutation: changed K87 to D and M89 to D
• GenBank ID: NM_004738.3
• Entrez Gene: VAPB (a.k.a. ALS8, VAMP-B, VAP-B)
• Tags / Fusion Proteins:
  • EGFP (N terminal on backbone)
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: GATCACATGGTCCTGCTG
• 3′ sequencing primer: GAGGTTTTACTTGCTTTAAA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Kentaro Hanada (VAP-B cDNA) Reference: Kawano M et al, J Biol Chem. 2006 Oct 6;281(40):30279-88. PMID: 16895911
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry