Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKL06
(Plasmid #104430)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104430 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p416
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 8015
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Super Ecliptic pHluorin-mRuby2
  • Alt name
    SEP-Cterminal-mRuby2
  • Species
    Synthetic
  • Insert Size (bp)
    1500
  • Promoter Tef1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTTTCGATGACCTCCCATTG
  • 3′ sequencing primer CTCCGTGTTAGGTTCCCATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ordered as gBlock from IDT
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKL06 was a gift from Joel Kralj (Addgene plasmid # 104430 ; http://n2t.net/addgene:104430 ; RRID:Addgene_104430)
  • For your References section:

    Live Cell Imaging Reveals pH Oscillations in Saccharomyces cerevisiae During Metabolic Transitions. Dodd BJT, Kralj JM. Sci Rep. 2017 Oct 24;7(1):13922. doi: 10.1038/s41598-017-14382-0. 10.1038/s41598-017-14382-0 [pii] PubMed 29066766