PIA900
(Plasmid #104401)

• Purpose: Polycistronic vector for expression of E. coli core RNAP
• Depositing Lab: Irina Artsimovitch
• Publication: Svetlov et al Methods Mol Biol. 2015;1276:13-29. doi: 10.1007/978-1-4939-2392-2_2.

Backbone

• Vector backbone: pET
• Backbone manufacturer: Novagen
• Total vector size (bp): 15247
• Vector type: Bacterial Expression ; E. coli expression vector

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rpoA, B, C, and Z
• Species: E. coli
• Promoter: T7
• Tag / Fusion Protein:
  • encodes a C-terminally His-tagged rpoC which can be removed using TEV protease. (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe1 (unknown if destroyed)
• 3′ cloning site: Stu1 (unknown if destroyed)
• 5′ sequencing primer: T7 TAATACGACTCACTATAGGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pIA900 (rpoA, B, C, and Z) encodes a C-terminally His-tagged β′ which can be removed using TEV protease. Linker with TEV-His10 cloned between NheI and StuI sites of pIA787; NheI site is gone