-
Purposevector for expression of single E.coli RNAP subunit
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28b
- Backbone size w/o insert (bp) 5368
- Total vector size (bp) 7153
-
Modifications to backbonefilled in XhoI site in pET28B, recloned XbaI-HindIII fragment from pET70-σ70 into pIA585 = unique XhoI site in rpoD
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerpoD
-
SpeciesE. coli
- Promoter T7
-
Tag
/ Fusion Protein
- His6 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba 1 (unknown if destroyed)
- 3′ cloning site Hind III (unknown if destroyed)
- 5′ sequencing primer T7 TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
T7P–His6-rpoD; N-terminally tagged σ70 subunit under control of the T7 gene 10 promoter
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PIA586 was a gift from Irina Artsimovitch (Addgene plasmid # 104399 ; http://n2t.net/addgene:104399 ; RRID:Addgene_104399) -
For your References section:
Purification of bacterial RNA polymerase: tools and protocols. Svetlov V, Artsimovitch I. Methods Mol Biol. 2015;1276:13-29. doi: 10.1007/978-1-4939-2392-2_2. 10.1007/978-1-4939-2392-2_2 PubMed 25665556