PVS10
(Plasmid #104398)

• Purpose: polycistronic vector for expression of E. coli core RNAP
• Depositing Lab: Irina Artsimovitch
• Publication: Svetlov et al Methods Mol Biol. 2015;1276:13-29. doi: 10.1007/978-1-4939-2392-2_2.

Backbone

• Vector backbone: pET
• Backbone manufacturer: Novagen
• Total vector size (bp): 15205
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rpoA-rpoB-rpoC-6xHis and rpoZ
• Species: E. coli
• Entrez Gene: rpoA (a.k.a. b3295, ECK3282, pez, phs, sez)
• Entrez Gene: rpoB (a.k.a. b3987, ECK3978, ftsR, groN, nitB, rif, ron, sdgB, stl, stv, tabD)
• Entrez Gene: rpoC (a.k.a. b3988, ECK3979, tabB)
• Entrez Gene: rpoZ (a.k.a. b3649, ECK3639, spoS)
• Promoter: T7
• Tag / Fusion Protein:
  • His6 (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ cloning site: Nde 1 (unknown if destroyed)
• 3′ cloning site: Not 1 (unknown if destroyed)
• 5′ sequencing primer: T7 TAATACGACTCACTATAGGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid pVS10 encodes the E. coli rpoA-rpoB-rpoC [His6] and
rpoZ ORFs under control of T7 promoter.