Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRISPR-Cas9/CD4-TK2
(Plasmid #104397)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104397 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Geneart CRISPR nuclease vector
  • Backbone manufacturer
    ThermoFisher
  • Vector type
    Mammalian Expression
  • Selectable markers
    CD4 surface marker

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TK2
  • Alt name
    thymidine kinase 2
  • gRNA/shRNA sequence
    TGTACCACGATGCCTCTCGC
  • Species
    H. sapiens (human)
  • Entrez Gene
    TK2 (a.k.a. MTDPS2, MTTK, PEOB3, SCA31, TK2-EXT)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR-Cas9/CD4-TK2 was a gift from Jeronimo Blanco (Addgene plasmid # 104397 ; http://n2t.net/addgene:104397 ; RRID:Addgene_104397)
  • For your References section:

    CRISPR/Cas9-Mediated Knockin Application in Cell Therapy: A Non-viral Procedure for Bystander Treatment of Glioma in Mice. Meca-Cortes O, Guerra-Rebollo M, Garrido C, Borros S, Rubio N, Blanco J. Mol Ther Nucleic Acids. 2017 Sep 15;8:395-403. doi: 10.1016/j.omtn.2017.07.012. Epub 2017 Jul 18. 10.1016/j.omtn.2017.07.012 PubMed 28918039