pCRISPR-Cas9/CD4-TK2
(Plasmid
#104397)
-
PurposeThe designed sgRNA cloned into this plasmid directs the specific DNA cleavage exerted by Cas9 nuclease in a region of exon 5 of the human TK2 gene. The plasmid also includes the Cas9 nuclease and CD4.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneGeneart CRISPR nuclease vector
-
Backbone manufacturerThermoFisher
-
Vector typeMammalian Expression
-
Selectable markersCD4 surface marker
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTK2
-
Alt namethymidine kinase 2
-
gRNA/shRNA sequenceTGTACCACGATGCCTCTCGC
-
SpeciesH. sapiens (human)
-
Entrez GeneTK2 (a.k.a. MTDPS2, MTTK, PEOB3, SCA31, TK2-EXT)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer U6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-Cas9/CD4-TK2 was a gift from Jeronimo Blanco (Addgene plasmid # 104397 ; http://n2t.net/addgene:104397 ; RRID:Addgene_104397) -
For your References section:
CRISPR/Cas9-Mediated Knockin Application in Cell Therapy: A Non-viral Procedure for Bystander Treatment of Glioma in Mice. Meca-Cortes O, Guerra-Rebollo M, Garrido C, Borros S, Rubio N, Blanco J. Mol Ther Nucleic Acids. 2017 Sep 15;8:395-403. doi: 10.1016/j.omtn.2017.07.012. Epub 2017 Jul 18. 10.1016/j.omtn.2017.07.012 PubMed 28918039