myc-hIFITM3-P17A,P18A
(Plasmid
#104364)
-
PurposeExpresses human IFITM3-P17A,P18A with an N-terminal myc tag in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-myc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4202
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFITM3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)402
-
Mutationmutated amino acids as follows: P17A,P18A
-
Entrez GeneIFITM3 (a.k.a. 1-8U, DSPA2b, IP15)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Sal1 (not destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
myc-hIFITM3-P17A,P18A was a gift from Jacob Yount (Addgene plasmid # 104364 ; http://n2t.net/addgene:104364 ; RRID:Addgene_104364) -
For your References section:
E3 Ubiquitin Ligase NEDD4 Promotes Influenza Virus Infection by Decreasing Levels of the Antiviral Protein IFITM3. Chesarino NM, McMichael TM, Yount JS. PLoS Pathog. 2015 Aug 11;11(8):e1005095. doi: 10.1371/journal.ppat.1005095. eCollection 2015 Aug. 10.1371/journal.ppat.1005095 PubMed 26263374