myc-hIFITM3-delta59-68
(Plasmid
#104361)
-
PurposeExpresses human IFITM3-delta59-68 with an N-terminal myc tag in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104361 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-myc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4172
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFITM3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)372
-
Mutationdeleted amino acids 59 through 68
-
Entrez GeneIFITM3 (a.k.a. 1-8U, DSPA2b, IP15)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Sal1 (not destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
myc-hIFITM3-delta59-68 was a gift from Jacob Yount (Addgene plasmid # 104361 ; http://n2t.net/addgene:104361 ; RRID:Addgene_104361) -
For your References section:
IFITM3 requires an amphipathic helix for antiviral activity. Chesarino NM, Compton AA, McMichael TM, Kenney AD, Zhang L, Soewarna V, Davis M, Schwartz O, Yount JS. EMBO Rep. 2017 Oct;18(10):1740-1751. doi: 10.15252/embr.201744100. Epub 2017 Aug 23. 10.15252/embr.201744100 PubMed 28835547