pEGFP-N-Drd1
(Plasmid #104358)

• Purpose: Expresses mouse dopamine receptor subtype 1 with EGFP fused to the C-terminus of the receptor. Localizes to primary cilia.
• Depositing Lab: Kirk Mykytyn
• Publication: Domire et al Cell Mol Life Sci. 2011 Sep;68(17):2951-60. doi: 10.1007/s00018-010-0603-4. Epub 2010 Dec 9.

Backbone

• Vector backbone: pEGFP-N
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 6134
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Dopamine receptor D1 (Drd1)
• Species: M. musculus (mouse)
• Insert Size (bp): 1434
• Entrez Gene: Drd1 (a.k.a. C030036C15Rik, Drd-1, Drd1a, Gpcr15)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho 1 (not destroyed)
• 3′ cloning site: Kpn1 (not destroyed)
• 5′ sequencing primer: CMV-F, CGCAAATGGGCGGTAGGCGTG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry