pcDNA3.1(-)-LZ-CD95L
(Plasmid #104349)

• Purpose: Expresses human CD95L leucine zipper in mammalian cells
• Depositing Lab: Alexander McLellan
• Publication: Rad S M et al PLoS One. 2020 Jul 24;15(7):e0232915. doi: 10.1371/journal.pone.0232915. eCollection 2020.

Backbone

• Vector backbone: pcDNA3.1(-)
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6117
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD95L leucine zipper
• Species: H. sapiens (human)
• Insert Size (bp): 717
• GenBank ID: NM_000639.2
• Entrez Gene: FASLG (a.k.a. ALPS1B, APT1LG1, APTL, CD178, CD95-L, CD95L, FASL, TNFSF6, TNLG1A)
• Promoter: CMV
• Tag / Fusion Protein:
  • octahistidine tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • huCD95L in pcDNA3.1-.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Synthetic DNA encoding a fusion of an improved IL2 signal sequence (Zhang et al. 2005 & Naito et al. 2013), an octahistidine-tagged-leucine zipper motif, a flexible 17aa linker (Naito et al. 2013) and the death inducing, c-terminal extracellular domain (aa137-208) of CD95L. The cloning strategy omits the proteolytically-susceptible extracellular stalk region (aa102-136), but includes the extracellular self-assembly domain (aa137-183; Orlinick et al. 1997). NTA column purified LZ-CD95L produced in expi393 cells is highly active (IC50 Jurkat E6-1 cells < 50ng/ml). Human CD95L is also active in inducing cell death in murine thymocytes (McLellan et al. 2000). Note, during following transient transfection, rising levels of LZ-CD95L in the culture supernatant induce cell death in HEK293FT and expi293. Users could explore co-transfection of this vector with a c-FLIP-encoding vector, select CD95L resistant HEK293 variants, or use other CD95L-resistant mammalian cell lines to maximise LZ-CD95L yields.

References:

McLellan AD, Terbeck G, Mengling T, Starling GC, Kiener PA, Gold R, Bröcker EB, Leverkus M, Kämpgen E. Differential susceptibility to CD95 (Apo-1/Fas) and MHC class II-induced apoptosis during murine dendritic cell development. Cell Death Differ. 2000 Oct;7(10):933-8.

Naito M, Hainz U, Burkhardt UE, Fu B, Ahove D, Stevenson KE, Rajasagi M, Zhu B, Alonso A, Witten E, Matsuoka K, Neuberg D, Duke-Cohan JS, Wu CJ, and Freeman GJ. CD40L-Tri, a novel formulation of recombinant human CD40L that effectively activates B cells. Cancer Immunol Immunother 2013; 62:347-357.

Orlinick JR, Elkon KB, and Chao MV. Separate domains of the human fas ligand dictate self-association and receptor binding. J Biol Chem 1997; 272:32221-32229.

Zhang L, Leng Q, and Mixson AJ. Alteration in the IL-2 signal peptide affects secretion of proteins in vitro and in vivo. The Journal of Gene Medicine 2005; 7:354-365.