-
PurposeExpresses human IL-2 (C125S)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQE80L
-
Backbone manufacturerqIAGEN
- Backbone size w/o insert (bp) 4751
- Total vector size (bp) 5115
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBL21 for protein expression
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman IL-2 (C125S)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)410
-
MutationC125S mutation (TGT -> TCC)
-
GenBank IDNM_000586.3
-
Entrez GeneIL2 (a.k.a. IL-2, TCGF, lymphokine)
- Promoter T5
-
Tag
/ Fusion Protein
- MRGSHHHHHGS-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGGATAACAATTTCACACAG
- 3′ sequencing primer GTTCTGAGGTCATTACTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byIDT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Like the FDA approved Proleukin (Aldesleukin), the sequence contains a C125S mutation (TGT -> TCC) to prevent cysteine mispairing in E. coli, but this does not affect biological activity (Wang et al. 1984) Expression and inclusion body preparation was carried out essentially as described in Carmenate et al. (2013), except that the 6M guanidine solubilised IL-2 was applied directly to an NTA column at 1 column volume / minute. LPS was removed with 0.1% Triton X114 / TE washes following by on-column re-folding with TE buffer. NTA-purified His-IL-2 exhibited identical activity to commercially sourced (tag-free) IL-2 (Peprotech).
References:
Wang A, Lu SD, and Mark DF. Site-specific mutagenesis of the human interleukin-2 gene: structure-function analysis of the cysteine residues. Science 1984; 224:1431-1433.
Carmenate T, Pacios A, Enamorado M, Moreno E, Garcia-Martinez K, Fuente D, and Leon K. Human IL-2 mutein with higher antitumor efficacy than wild type IL-2. J. Immunol. 2013; 190:6230-6238.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE80L-IL2 C125S was a gift from Alexander McLellan (Addgene plasmid # 104348 ; http://n2t.net/addgene:104348 ; RRID:Addgene_104348)