Skip to main content
Addgene

pQE80L-IL2 C125S
(Plasmid #104348)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104348 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pQE80L
  • Backbone manufacturer
    qIAGEN
  • Backbone size w/o insert (bp) 4751
  • Total vector size (bp) 5115
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    BL21 for protein expression
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human IL-2 (C125S)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    410
  • Mutation
    C125S mutation (TGT -> TCC)
  • GenBank ID
    NM_000586.3
  • Entrez Gene
    IL2 (a.k.a. IL-2, TCGF, lymphokine)
  • Promoter T5
  • Tag / Fusion Protein
    • MRGSHHHHHGS-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGGATAACAATTTCACACAG
  • 3′ sequencing primer GTTCTGAGGTCATTACTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    IDT

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Like the FDA approved Proleukin (Aldesleukin), the sequence contains a C125S mutation (TGT -> TCC) to prevent cysteine mispairing in E. coli, but this does not affect biological activity (Wang et al. 1984) Expression and inclusion body preparation was carried out essentially as described in Carmenate et al. (2013), except that the 6M guanidine solubilised IL-2 was applied directly to an NTA column at 1 column volume / minute. LPS was removed with 0.1% Triton X114 / TE washes following by on-column re-folding with TE buffer. NTA-purified His-IL-2 exhibited identical activity to commercially sourced (tag-free) IL-2 (Peprotech).

References:
Wang A, Lu SD, and Mark DF. Site-specific mutagenesis of the human interleukin-2 gene: structure-function analysis of the cysteine residues. Science 1984; 224:1431-1433.

Carmenate T, Pacios A, Enamorado M, Moreno E, Garcia-Martinez K, Fuente D, and Leon K. Human IL-2 mutein with higher antitumor efficacy than wild type IL-2. J. Immunol. 2013; 190:6230-6238.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQE80L-IL2 C125S was a gift from Alexander McLellan (Addgene plasmid # 104348 ; http://n2t.net/addgene:104348 ; RRID:Addgene_104348)