Skip to main content
Addgene

tet-pLKO-sgRNA-puro
(Plasmid #104321)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104321 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    tet-pLKO-puro
  • Backbone size (bp) 8800
  • Modifications to backbone
    shRNA encoding to sgRNA encoding
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter H1/TO
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tet-pLKO-seq-1: 5’- GTTTCAGACCCACCTCCCAAC’-3
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tet-pLKO-sgRNA-puro was a gift from Nathanael Gray (Addgene plasmid # 104321 ; http://n2t.net/addgene:104321 ; RRID:Addgene_104321)

  • For your References section:

    MELK is not necessary for the proliferation of basal-like breast cancer cells. Huang HT, Seo HS, Zhang T, Wang Y, Jiang B, Li Q, Buckley DL, Nabet B, Roberts JM, Paulk J, Dastjerdi S, Winter GE, McLauchlan H, Moran J, Bradner JE, Eck MJ, Dhe-Paganon S, Zhao JJ, Gray NS. Elife. 2017 Sep 19;6. pii: e26693. doi: 10.7554/eLife.26693. 10.7554/eLife.26693 PubMed 28926338
Related items:
Commonly requested with: