Skip to main content
Addgene

1kb Zfp521 promoter reporter
(Plasmid #104188)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104188 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGL3-Basic
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 5802
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zfp521 promoter - 1 Kb
  • Alt name
    Evi3
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Zfp521 (a.k.a. B930086A16Rik, Evi3, Znf521)
  • Promoter none
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer RVprimer3 . CTAGCAAAATAGGCTGTCCC
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pGL3 backbone is a promoterless vector used for measuring the activity of inserted promoter sequences with a luciferase assay.

Primers used to clone 1Kb Zfp521 promoter:
Forward: cgtttaaaaactattttcttatccaga
Reverse: aatggaaaatccaagcaagg

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1kb Zfp521 promoter reporter was a gift from Kathryn Hentges (Addgene plasmid # 104188 ; http://n2t.net/addgene:104188 ; RRID:Addgene_104188)

  • For your References section:

    Transcriptional regulation of the proto-oncogene Zfp521 by SPI1 (PU.1) and HOXC13. Yu M, Al-Dallal S, Al-Haj L, Panjwani S, McCartney AS, Edwards SM, Manjunath P, Walker C, Awgulewitsch A, Hentges KE. Genesis. 2016 Oct;54(10):519-533. doi: 10.1002/dvg.22963. Epub 2016 Aug 29. 10.1002/dvg.22963 PubMed 27506447
Related items:
Commonly requested with: