pNGVL4a-hCRTmE6mE7mL2
(Plasmid
#104153)
-
PurposeExpresses human calreticulin fused to MmuPV1 E6, MmuPV1 E7 and MmuPV1 L2 residues 11-210 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepNGVL4a
- Total vector size (bp) 7049
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehCRTmE6mE7mL2 11-210
-
Alt namehCRT
-
Alt nameMmuPV1 E6, MmuPV1 E7, MmuPV1 L2
-
SpeciesH. sapiens (human); MmuPV1
-
Insert Size (bp)2624
-
Mutationresidues 11 to 200 of the late protein L2
-
GenBank IDNP_004334.1
-
Entrez GeneCALR (a.k.a. CALR1, CRT, HEL-S-99n, RO, SSA, cC1qR)
-
Entrez GeneE6 (a.k.a. MmPv1_gp1)
-
Entrez GeneE7 (a.k.a. MmPv1_gp2)
-
Entrez GeneL2 (a.k.a. MmPv1_gp6)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGGAAACGCCTGGTATCTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNGVL4a-hCRTmE6mE7mL2 was a gift from Richard Roden (Addgene plasmid # 104153 ; http://n2t.net/addgene:104153 ; RRID:Addgene_104153) -
For your References section:
Spontaneous and Vaccine-Induced Clearance of Mus Musculus Papillomavirus 1 Infection. Jiang RT, Wang JW, Peng S, Huang TC, Wang C, Cannella F, Chang YN, Viscidi RP, Best SRA, Hung CF, Roden RBS. J Virol. 2017 Jul 12;91(15). pii: e00699-17. doi: 10.1128/JVI.00699-17. Print 2017 Aug 1. 10.1128/JVI.00699-17 PubMed 28515303