Skip to main content
Addgene

LZF70: Cre-off hSyn-QuasAr3-dark Citrine (FAS)
(Plasmid #104117)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104117 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    fsyn-cre-off
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 10275
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    QuasAr3-dark Citrine
  • Species
    Synthetic
  • Insert Size (bp)
    1800
  • Promoter human synapsin I

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGAGAGCGCAGTCGAGAAG
  • 3′ sequencing primer tcacaaattttgtaatccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LZF70: Cre-off hSyn-QuasAr3-dark Citrine (FAS) was a gift from Adam Cohen (Addgene plasmid # 104117 ; http://n2t.net/addgene:104117 ; RRID:Addgene_104117)
  • For your References section:

    All-optical synaptic electrophysiology probes mechanism of ketamine-induced disinhibition. Fan LZ, Nehme R, Adam Y, Jung ES, Wu H, Eggan K, Arnold DB, Cohen AE. Nat Methods. 2018 Oct;15(10):823-831. doi: 10.1038/s41592-018-0142-8. Epub 2018 Oct 1. 10.1038/s41592-018-0142-8 PubMed 30275587