KCC2-pHext
(Plasmid #104076)

• Purpose: To visualize the expression and localization of potassium-chloride cotransporter type 2 (KCC2)
• Depositing Lab: Igor Medyna
• Publication: Friedel et al eNeuro. 2017 Jul 21;4(4). pii: ENEURO.0055-17.2017. doi: 10.1523/ENEURO.0055-17.2017. eCollection 2017 Jul-Aug.

Backbone

• Vector backbone: EGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4807
• Total vector size (bp): 8157
• Modifications to backbone: CMV promoter replaced by UbC promoter
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KCC2 (b isoform)
• Alt name: Slc12a5
• Species: R. norvegicus (rat)
• Insert Size (bp): 3350
• Mutation: EcoR1 site in rat KCC2 was removed by silent mutation, A3267G in rat coding sequence. Two sets of silent mutations render construct resistant to shRNA K10 (~3482) and K11(~4793).
• Entrez Gene: Slc12a5 (a.k.a. Kcc2)
• Promoter: UbC
• Tag / Fusion Protein:
  • pHluorine tag inserted in the second putative transmembrane domain of KCC2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind III (unknown if destroyed)
• 3′ cloning site: Eco R1 (unknown if destroyed)
• 5′ sequencing primer: UbC TGAAGCTCCGGTTTTGAACT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

In order to directly visualize the insertion of KCC2 IGE variants into the
membranes of single neurons, we created a novel construct encoding KCC2 with a pHluorine tag introduced into the second extracellular loop of the transporter , KCC2-pHex. See attached Scheme of KCC2-ext.pdf