Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

KCC2-pHext
(Plasmid #104076)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104076 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    EGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4807
  • Total vector size (bp) 8157
  • Modifications to backbone
    CMV promoter replaced by UbC promoter
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KCC2 (b isoform)
  • Alt name
    Slc12a5
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3350
  • Mutation
    EcoR1 site in rat KCC2 was removed by silent mutation, A3267G in rat coding sequence. Two sets of silent mutations render construct resistant to shRNA K10 (~3482) and K11(~4793).
  • Entrez Gene
    Slc12a5 (a.k.a. Kcc2)
  • Promoter UbC
  • Tag / Fusion Protein
    • pHluorine tag inserted in the second putative transmembrane domain of KCC2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (unknown if destroyed)
  • 3′ cloning site Eco R1 (unknown if destroyed)
  • 5′ sequencing primer UbC TGAAGCTCCGGTTTTGAACT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In order to directly visualize the insertion of KCC2 IGE variants into the
membranes of single neurons, we created a novel construct encoding KCC2 with a pHluorine tag introduced into the second extracellular loop of the transporter , KCC2-pHex. See attached Scheme of KCC2-ext.pdf

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KCC2-pHext was a gift from Igor Medyna (Addgene plasmid # 104076 ; http://n2t.net/addgene:104076 ; RRID:Addgene_104076)
  • For your References section:

    A Novel View on the Role of Intracellular Tails in Surface Delivery of the Potassium-Chloride Cotransporter KCC2. Friedel P, Ludwig A, Pellegrino C, Agez M, Jawhari A, Rivera C, Medina I. eNeuro. 2017 Jul 21;4(4). pii: ENEURO.0055-17.2017. doi: 10.1523/ENEURO.0055-17.2017. eCollection 2017 Jul-Aug. eN-NWR-0055-17 [pii] PubMed 28785725