pEB2-2ndVal mCherry2-L
(Plasmid #104027)

• Purpose: Plasmid encoding 2ndVal mCherry2-L
• Depositing Lab: Philippe Cluzel
• Publication: Balleza et al Nat Methods. 2018 Jan;15(1):47-51. doi: 10.1038/nmeth.4509. Epub 2017 Nov 20.

Backbone

• Vector backbone: pEB2
• Backbone size w/o insert (bp): 3224
• Total vector size (bp): 3935
• Modifications to backbone: See "Notes On Plasmids In This Collection"
• Vector type: Bacterial Expression ; Low copy

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): MG1655
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 2ndVal mCherry2-L
• Species: Synthetic
• Insert Size (bp): 711
• Mutation: mCherry2-L with valine inserted in 2nd position
• Promoter: proC

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGTATCACGAGGCCCTTTC
• 3′ sequencing primer: AAAGGGAAAACTGTCCATATGCAC

Resource Information

• Supplemental Documents:
  • Notes On Plasmids In This Collection
  • pEB2-2ndVal mCherry2-L.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a version of mCherry2-L with a valine inserted in the second position. Please see "Notes On Plasmids In This Collection" document for further details and references.