Skip to main content
Addgene

pEB2-2ndVal mCherry2-L
(Plasmid #104027)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104027 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEB2
  • Backbone size w/o insert (bp) 3224
  • Total vector size (bp) 3935
  • Modifications to backbone
    See "Notes On Plasmids In This Collection"
  • Vector type
    Bacterial Expression ; Low copy

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    MG1655
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    2ndVal mCherry2-L
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • Mutation
    mCherry2-L with valine inserted in 2nd position
  • Promoter proC

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGTATCACGAGGCCCTTTC
  • 3′ sequencing primer AAAGGGAAAACTGTCCATATGCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a version of mCherry2-L with a valine inserted in the second position. Please see "Notes On Plasmids In This Collection" document for further details and references.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEB2-2ndVal mCherry2-L was a gift from Philippe Cluzel (Addgene plasmid # 104027 ; http://n2t.net/addgene:104027 ; RRID:Addgene_104027)
  • For your References section:

    Systematic characterization of maturation time of fluorescent proteins in living cells. Balleza E, Kim JM, Cluzel P. Nat Methods. 2018 Jan;15(1):47-51. doi: 10.1038/nmeth.4509. Epub 2017 Nov 20. 10.1038/nmeth.4509 PubMed 29320486