pEB1-comClover3
(Plasmid #104023)

• Purpose: Plasmid encoding comClover3
• Depositing Lab: Philippe Cluzel
• Publication: Balleza et al Nat Methods. 2018 Jan;15(1):47-51. doi: 10.1038/nmeth.4509. Epub 2017 Nov 20.

Backbone

• Vector backbone: pEB1
• Backbone size w/o insert (bp): 3674
• Total vector size (bp): 4391
• Modifications to backbone: Derived from pUA66. Inserted constitutive promoter proC. Replaced original insert with FP of interest.
• Vector type: Bacterial Expression ; Low copy

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): MG1655
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: comClover3
• Species: Synthetic
• Insert Size (bp): 717
• Mutation: Same protein sequence as mClover3 (codon optimized nucleotide sequence)
• Promoter: proC

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGTATCACGAGGCCCTTTC
• 3′ sequencing primer: AAAGGGAAAACTGTCCATATGCAC

Resource Information

• Supplemental Documents:
  • pEB1-comClover3.gb
  • Notes On Plasmids In This Collection
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a codon optimized version of mClover3. Please see "Notes On Plasmids In This Collection" document for further details and references.