pEB2-Katushka-9-5
(Plasmid #104011)

• Purpose: Plasmid encoding Katushka-9-5
• Depositing Lab: Philippe Cluzel
• Publication: Balleza et al Nat Methods. 2018 Jan;15(1):47-51. doi: 10.1038/nmeth.4509. Epub 2017 Nov 20.

Backbone

• Vector backbone: pEB2
• Backbone size w/o insert (bp): 3224
• Total vector size (bp): 3920
• Modifications to backbone: See "Notes On Plasmids In This Collection"
• Vector type: Bacterial Expression ; Low copy

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): MG1655
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Katushka9-5
• Species: Synthetic
• Insert Size (bp): 696
• Mutation: Mutations relative to eqFP578 (K6S, N21D, R32G, L79F, I115L, S131P, N143S, G152S, F174L, H193Y, H197R, R198K, K220R, R231S)
• Promoter: proC

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGTATCACGAGGCCCTTTC
• 3′ sequencing primer: AAAGGGAAAACTGTCCATATGCAC

Resource Information

• Supplemental Documents:
  • Notes On Plasmids In This Collection
  • pEB2-Katushka9-5.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This FP derives from eqFP578. Please see "Notes On Plasmids In This Collection" document for further details and references.