pEB2-mScarlet-I
(Plasmid #104007)

• Purpose: Plasmid encoding mScarlet-I
• Depositing Lab: Philippe Cluzel
• Publication: Balleza et al Nat Methods. 2018 Jan;15(1):47-51. doi: 10.1038/nmeth.4509. Epub 2017 Nov 20.

Backbone

• Vector backbone: pEB2
• Backbone size w/o insert (bp): 3224
• Total vector size (bp): 3920
• Modifications to backbone: See "Notes On Plasmids In This Collection"
• Vector type: Bacterial Expression ; Low copy

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): MG1655
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mScarlet-I
• Species: Synthetic
• Insert Size (bp): 696
• Mutation: Mutations relative to DsRed (MSKGE AVIKEF… N6A, R17H, T21S, V22M, H41T, N42Q, V44A, A57S, Q66M, K70R, V71A, Y72F, V73I, K83Y, L85Q, V104A, S111T, Q114E, C117T, F118L, F124L, I125R, V127T, S131P, R153E, E160D, H162K, K163M, K166R, H172R, V175A, E176D, S179T, I180T, M182K, L189M, Y192A, Y194N, S197R, I210V, T217S, H222S, L223T, F224G … EGRHSTG GMDELYK)
• Promoter: proC

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGTATCACGAGGCCCTTTC
• 3′ sequencing primer: AAAGGGAAAACTGTCCATATGCAC

Resource Information

• Supplemental Documents:
  • Notes On Plasmids In This Collection
  • pEB2-mScarlet-I.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This FP derives from DsRed. Please see "Notes On Plasmids In This Collection" document for further details and references.