pEB1-sfGFP
(Plasmid #103983)

• Purpose: Plasmid encoding sfGFP
• Depositing Lab: Philippe Cluzel
• Publication: Balleza et al Nat Methods. 2018 Jan;15(1):47-51. doi: 10.1038/nmeth.4509. Epub 2017 Nov 20.

Backbone

• Vector backbone: pEB1
• Backbone size w/o insert (bp): 3674
• Total vector size (bp): 4391
• Modifications to backbone: Derived from pUA66. Inserted constitutive promoter proC. Replaced original insert with FP of interest.
• Vector type: Bacterial Expression ; Low copy

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): MG1655
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: sfGFP
• Species: Synthetic
• Insert Size (bp): 717
• Mutation: Mutations relative to wild-type GFP (S30R, Y39N, F64L, S65T, F99S, N105T, Y145F, M153T, V163A, I171V, A206V)
• Promoter: proC

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGTATCACGAGGCCCTTTC
• 3′ sequencing primer: AAAGGGAAAACTGTCCATATGCAC

Resource Information

• Supplemental Documents:
  • pEB1-sfGFP.gb
  • Notes On Plasmids In This Collection
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This FP derives from wtGFP. In this plasmid, the FP is coded with the original wtGFP nucleotide coding sequence except where mutations specific to the FP occur (see map). Please see "Notes On Plasmids In This Collection" document for further details and references.