-
PurposeMammalian expression of fluorescent protein Dendra2 used for transfection efficiency control
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 6327
- Total vector size (bp) 7019
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDendra2
-
Insert Size (bp)693
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GTTTAAACTTAAGCTTGCCACCATGGATGAGGAAATCGC
- 3′ sequencing primer AAACGGGCCCTCTAGATTACCACACCTGGCTGGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1 Dendra2 was a gift from Qing Deng (Addgene plasmid # 103967 ; http://n2t.net/addgene:103967 ; RRID:Addgene_103967) -
For your References section:
Overexpression of microRNA-722 fine-tunes neutrophilic inflammation through inhibiting Rac2 in zebrafish. Hsu AY, Wang D, Gurol T, Zhou W, Zhu X, Lu HY, Deng Q. Dis Model Mech. 2017 Sep 27. pii: dmm.030791. doi: 10.1242/dmm.030791. 10.1242/dmm.030791 PubMed 28954734