Skip to main content
Addgene

pUDP002
(Plasmid #103872)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 103872 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    not applicable
  • Backbone manufacturer
    Juergens H et al. Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA expression plasmid
  • Backbone size w/o insert (bp) 10046
  • Total vector size (bp) 10046
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    hph
  • Alt name
    HygR
  • Species
    Klebsiella pneumoniae
  • Insert Size (bp)
    1029
  • GenBank ID
    YP_007349547
  • Promoter Ashbya gossypii (Eremothecium gossypii) TEF1

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCCAGATCATCAATAGGCACG
  • 3′ sequencing primer TCTCGAGAGCTCCAGTATAGCG
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Spcas9 D147Y P411T
  • Species
    Streptococcus pyogenes
  • Mutation
    D147Y P411T
  • GenBank ID
    NP_269215.1 NC_002737.2 (854751..858857)
  • Promoter Arxula adeninivorans TEF1
  • Tag / Fusion Protein
    • NLS (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GTCCATAGTCAACAAGAGCCC
  • 3′ sequencing primer CAATCCTTTGCCGTAGTTTCAACG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    A patent on panARSOPT sequence used in pUDP series is pending (Pan-yeast autonomously replicating sequence WO 2014131056 A1). The legal status of Cas9 application is not yet sorted out. The Spcas9D147Y P411T gene presents on pUDP002 is derived from pCT (Plasmid #60620) obtained from Addgene under Material Transfer Agreement Instructions (Order 211742- our reference TNW15.216)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDP002 was a gift from Jean-Marc Daran (Addgene plasmid # 103872 ; http://n2t.net/addgene:103872 ; RRID:Addgene_103872)

  • For your References section:

    Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA co-expression plasmid. Juergens H, Varela JA, Gorter de Vries AR, Perli T, Gast VJM, Gyurchev NY, Rajkumar AS, Mans R, Pronk JT, Morrissey JP, Daran JG. FEMS Yeast Res. 2018 May 1;18(3). pii: 4847887. doi: 10.1093/femsyr/foy012. 10.1093/femsyr/foy012 PubMed 29438517
Related items:
Commonly requested with: