-
PurposeBackbone for cloning guides that are compatible with LwaCas13a. Contains a 5' direct repeat. Clone using BbsI (BpiI). F overhang AAAC. R overhang AAAA
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 2962
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-LwaCas13aDR-BbsI-BbsI-polyT
-
Insert Size (bp)314
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Benchling link: https://benchling.com/s/seq-0SqKieU2CWyd3RRawuKp
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC0040-LwaCas13a crRNA backbone was a gift from Feng Zhang (Addgene plasmid # 103851 ; http://n2t.net/addgene:103851 ; RRID:Addgene_103851) -
For your References section:
RNA editing with CRISPR-Cas13. Cox DBT, Gootenberg JS, Abudayyeh OO, Franklin B, Kellner MJ, Joung J, Zhang F. Science. 2017 Oct 25. pii: eaaq0180. doi: 10.1126/science.aaq0180. 10.1126/science.aaq0180 PubMed 29070703
Map uploaded by the depositor.
