pC0039-CMV-dPspCas13b-GS-ADAR2DD(E488Q)
(Plasmid #103849)

• Purpose: dPspCas13b-ADAR2DD(E488Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNA.
• Depositing Lab: Feng Zhang
• Publication: Cox et al Science. 2017 Oct 25. pii: eaaq0180. doi: 10.1126/science.aaq0180.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 9846
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PspCas13b
• Species: Prevotella sp. P5-125
• Insert Size (bp): 3270
• Mutation: Changed histidne 133 to alanine and histidine 1058 to alanine to remove RNAse activity.
• GenBank ID: WP_044065294
• Promoter: CMV
• Tag / Fusion Protein:
  • HIV NES (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Gene/Insert 2

• Gene/Insert name: huADAR2DD
• Alt name: human ADAR2 deaminase domain
• Species: H. sapiens (human)
• Insert Size (bp): 1158
• Mutation: Only the deaminase domain (AA 276-702 are expressed). Glutamate 488 is mutated to glutamine.
• Entrez Gene: ADARB1 (a.k.a. ADAR2, DRABA2, DRADA2, NEDHYMS, RED1)
• Promoter: CMV
• Tag / Fusion Protein:
  • GS (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGGGCAGCGACATCGTGTCCAAAGAGGAT

Resource Information

• Supplemental Documents:
  • pc0039-cmv-dpspcas13b-gs-adar2dde488q.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Benchling link: https://benchling.com/s/seq-arzpsupZEzGu3ghBDhtv