dCas-hHDAC3-R265P
(Plasmid #103786)

• Purpose: Expresses dCas9 fused to human HDAC3 with R265P mutation
• Depositing Lab: Zhaolan Zhou
• Publication: Kwon et al Nat Commun. 2017 May 12;8:15315. doi: 10.1038/ncomms15315.

Backbone

• Vector backbone: plenti
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: dCas9-HDAC3-R265P
• Alt name: histone deacetylase 3
• Species: H. sapiens (human), Synthetic; S. pyogenes
• Mutation: Changed arginine 265 to proline
• GenBank ID: NM_003883
• Entrez Gene: HDAC3 (a.k.a. HD3, KDAC3, RPD3, RPD3-2)
• Promoter: EF1A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: human HDAC3 cDNA from Addgene plasmid HDAC3-Flag (#13819) plenti vector containing dCas9_2A_Blast from Addgene plasmid (#61425)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The stop codon present after the HDAC3 open reading frame may interfere with expression of the blasticidin resistance cassette. Blasticidin selection has not been verified with this plasmid