LSB-hsa-miR-29a-3p
(Plasmid #103391)

• Purpose: Used to sense miRNA activity using fluorescence based tools. hsa-miR-29a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor Comments
• Depositing Lab: Ron Weiss
• Publication: Gam et al Nat Commun. 2018 Jun 22;9(1):2430. doi: 10.1038/s41467-018-04575-0.

Backbone

• Vector backbone: Low Sensor Backbone (LSB)
• Vector type: Mammalian Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hsa-miR-29a-3p target
• Species: H. sapiens (human)
• Entrez Gene: MIR29A (a.k.a. MIRN29, MIRN29A, hsa-mir-29, hsa-mir-29a, miRNA29A, mir-29a)
• Promoter: EF-1a

Cloning Information

• Cloning method: Gibson Cloning

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.