p413_Csy4NLS
(Plasmid
#103139)
-
PurposeExpresses Csy4-NLS under TEF promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep413 TEF
-
Backbone manufacturerATCC
- Backbone size w/o insert (bp) 5522
- Total vector size (bp) 6130
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCsy4
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)564
-
GenBank ID4AL5
- Promoter TEF
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGTCTTCAATTTCTCAAGT
- 3′ sequencing primer CTCCTTCCTTTTCGGTTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p413_Csy4NLS was a gift from Jens Nielsen (Addgene plasmid # 103139 ; http://n2t.net/addgene:103139 ; RRID:Addgene_103139) -
For your References section:
Multiplexed CRISPR/Cas9 Genome Editing and Gene Regulation using Csy4 in Saccharomyces cerevisiae. Ferreira R, Skrekas C, Nielsen J, David F. ACS Synth Biol. 2017 Nov 21. doi: 10.1021/acssynbio.7b00259. 10.1021/acssynbio.7b00259 PubMed 29161506